Phone:
+1 877 302 8632
Fax:
+1 888 205 9894 (Toll-free)
E-Mail:
orders@antibodies-online.com

CRISPR-Cas9 (Active) Protein

Origin: Streptococcus pyogenes Host: Escherichia coli (E. coli) Recombinant > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection. GEEN, IVCA, AbP Active
Catalog No. ABIN3071564
  • Target
    CRISPR-Cas9
    Protein Type
    Recombinant
    Biological Activity
    Active
    Origin
    • 6
    • 1
    Streptococcus pyogenes
    Source
    • 7
    Escherichia coli (E. coli)
    Application
    Genome Editing with Engineered Nucleases (GEEN), In vitro Cleavage Assay (IVCA), Antibody Production (AbP)
    Specificity
    Activity test
    Cas9 site-specific digestion:
    We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
    (CATCATTGGAAAACGTTCTT)
    can be digested with gRNA:
    (CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
    and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hours at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.
    Characteristics
    GenCrispr Cas9 Nuclease is produced by expression in an E. colistrain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes without nuclear localization signal (NLS).
    Purification
    purified
    Purity
    > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.
    Components
    GenCrispr Cas9 Nuclease
    10X Reaction Buffer
  • Application Notes
    Screening for highly efficient and specific targeting gRNAs by in vitro DNA cleavage using Cas9 Nuclease from S. pyogenes
    Highly purified Cas9 antigen could be used for specific antibody production.
    Restrictions
    For Research Use only
  • Concentration
    0.2 mg/mL
    Buffer
    10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
    1X Storage Buffer: 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % Glycerol pH 7.4 at 25 °C
    Preservative
    Dithiothreitol (DTT)
    Precaution of Use
    This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.
    Storage
    -20 °C
    Storage Comment
    GenCrispr Cas9 is supplied with 1X storage buffer (10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and is recommended to be stored at -20°C.br/>Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).
  • Target
    CRISPR-Cas9
    Alternative Name
    Cas9 Nuclease
    Background
    GenCrispr Cas9 Nuclease is the recombinant Streptococcus pyogenes Cas9 (wt) protein purified from E. coli that can be used for genome editing by inducing site-specific double stranded breaks in double stranded DNA. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The RNP complex recognizes the target site by matching gRNA with the genomic DNA sequence and produces DNA breaks within 3 bases from the NGG PAM (Protospacer Adjacent Motif). With GenCrispr Cas9 nuclease, customers can screen for highly efficient gRNA in vitro using DNA cleavage assays. The high purity Cas9 protein can also be used for antibody production.
You are here:
Support